WES identified an InDel (insertion and deletion) variation in the DMD gene

Name: WES identified an InDel (insertion and deletion) variation in the DMD gene
Published: 2022-11-14T04:00:23+00:00
License: https://creativecommons.org/publicdomain/zero/1.0/
Keywords: DMD mutation, Genetics

dataset

posted on 2022-11-14, 04:00 authored by Jing Zhang

WES identified an InDel (insertion and deletion) variation in the DMD gene, namely (NM_004006; exon11) c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC.