Table_2.xls (9.5 kB)
Download file

Primers used in this study.

Download (0 kB)
dataset
posted on 2013-02-19, 16:52 authored by Jae Myung Lee, Junhyeong Lee, Taesung Kim, Sung Kuk Lee
a

In envZ deletion and cI insertion, gene specific regions are underlined and P1 and P4 regions are indicated in bold letters.

b

In pJM1 and pJM2 construction, GAATTC, EcoRI site; GTCGAC, SalI site; AGCTACTAAAGCGTAGTTTTCGTCGTTTGCTGC, LVA site; AATAACACCGTGCGTGTT, CI binding site 1; TTTACCTCTGGCGGTG, CI binding site 2; AAGGAG, strong RBS (0.3); GGATTA, weak RBS (0.1). Homologous regions of primer 7 and primer 8 are indicated in bold letters.

History