Paraphelidium RNA-seq Assembly

2017-12-14T10:18:18Z (GMT) by Guifré Torruella

Reads for both yound and old libraries can be found in NCBI SRA: http://www.ncbi.nlm.nih.gov/bioproject/402032


Assembly was performed as follows:

#ADAPTER AND QUALITY TRIMMING

TrimmomaticPE: Started with arguments: -threads 7 -phred33 Paraphelidium_J_AGCGATAG-GTACTGAC_L002_R1_001.fastq.gz Paraphelidium_J_AGCGATAG-GTACTGAC_L002_R2_001.fastq.gz out1_Paraphelidium_J_PAIRED.fq.gz out1_Paraphelidium_J_UNPAIRED.fq.gz out2_Paraphelidium_J_PAIRED.fq.gz out2_Paraphelidium_J_UNPAIRED.fq.gz ILLUMINACLIP:adapters.fasta:2:30:10 SLIDINGWINDOW:4:30 HEADCROP:12 MINLEN:113
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 71015565 Both Surviving: 34844871 (49,07%) Forward Only Surviving: 6535164 (9,20%) Reverse Only Surviving: 8601196 (12,11%) Dropped: 21034334 (29,62%)
TrimmomaticPE: Completed successfully
guifre@guifre-Precision-T1700:~/Downloads/Trimmomatic-0.33$ java -jar trimmomatic-0.33.jar PE -threads 7 -phred33 Paraphelidium_V_AGCGATAG-CAGGACGT_L002_R1_001.fastq.gz Paraphelidium_V_AGCGATAG-CAGGACGT_L002_R2_001.fastq.gz out1_Paraphelidium_V_PAIRED.fq.gz out1_Paraphelidium_V_UNPAIRED.fq.gz out2_Paraphelidium_V_PAIRED.fq.gz out2_Paraphelidium_V_UNPAIRED.fq.gz ILLUMINACLIP:adapters.fasta:2:30:10 SLIDINGWINDOW:4:30 HEADCROP:12 MINLEN:113
TrimmomaticPE: Started with arguments: -threads 7 -phred33 Paraphelidium_V_AGCGATAG-CAGGACGT_L002_R1_001.fastq.gz Paraphelidium_V_AGCGATAG-CAGGACGT_L002_R2_001.fastq.gz out1_Paraphelidium_V_PAIRED.fq.gz out1_Paraphelidium_V_UNPAIRED.fq.gz out2_Paraphelidium_V_PAIRED.fq.gz out2_Paraphelidium_V_UNPAIRED.fq.gz ILLUMINACLIP:adapters.fasta:2:30:10 SLIDINGWINDOW:4:30 HEADCROP:12 MINLEN:113
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Skipping duplicate Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 58826379 Both Surviving: 25569845 (43,47%) Forward Only Surviving: 4563537 (7,76%) Reverse Only Surviving: 10063604 (17,11%) Dropped: 18629393 (31,67%)
TrimmomaticPE: Completed successfully
#TRINITY ASSEMBLY

bsub -m Amoeba-mt1 -n 48 -o Par_tr_trinity_stricttrim_out.txt -e Par_tr_trinity_stricttrim_err.txt Trinity --seqType fq --left out1_Paraphelidium_J_PAIRED.fq.gz,out1_Paraphelidium_J_UNPAIRED.fq.gz,out1_Paraphelidium_V_PAIRED.fq.gz,out1_Paraphelidium_V_UNPAIRED.fq.gz --right out2_Paraphelidium_J_PAIRED.fq.gz,out2_Paraphelidium_J_UNPAIRED.fq.gz,out2_Paraphelidium_V_PAIRED.fq.gz,out2_Paraphelidium_V_UNPAIRED.fq.gz --SS_lib_type RF --min_kmer_cov 2 --normalize_reads --CPU 48 --max_memory 250G --output standard_boved